HALOWERKBiowerk
phage matching
Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.
POST https://bio.halowerk.com/v1/phage-matchingEingaben
| Feld | Typ | Pflicht | Beschreibung |
|---|---|---|---|
| phage_sequence | string | Ja | |
| spacers | array | Ja | |
| max_mismatches | integer | Ja |
Vollständiges Eingabeschema anzeigen
{
"type": "object",
"required": [
"phage_sequence",
"spacers",
"max_mismatches"
],
"additionalProperties": false,
"properties": {
"phage_sequence": {
"type": "string",
"minLength": 1,
"maxLength": 10000,
"pattern": "^[ACGT]+$"
},
"spacers": {
"type": "array",
"minItems": 1,
"maxItems": 50,
"items": {
"type": "object",
"required": [
"id",
"sequence"
],
"additionalProperties": false,
"properties": {
"id": {
"type": "string",
"minLength": 1,
"maxLength": 128
},
"sequence": {
"type": "string",
"minLength": 15,
"maxLength": 60,
"pattern": "^[ACGT]+$"
}
}
}
},
"max_mismatches": {
"type": "integer",
"minimum": 0,
"maximum": 5
}
}
}Veröffentlichtes Eingabebeispiel
{
"phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
"spacers": [
{
"id": "spacer-1",
"sequence": "GGCTAACCGTTCGATC"
},
{
"id": "spacer-2",
"sequence": "ATGCCTGAATTCGGCA"
}
],
"max_mismatches": 2
}Ergebnis & Dokumentation
Maschinenlesbare Dokumentation dieses Hubs
Quelle dieser Seite: der veröffentlichte HALOWERK-Katalog. Stand: 2026-11-01, 15:19 UTC.
Weitere Endpunkte dieses Hubs
- Biowerk0,004 USDC
allergen epitope
POSThttps://bio.halowerk.com/v1/allergen-epitopeBuilds amino-acid k-mer sets, calculates Jaccard similarity, and finds the highest contiguous identity between each supplied epitope and any equal-length window of the query. It does not predict immune binding, allergenicity, cross-reactivi
- Biowerk0,003 USDC
biomarker longevity
POSThttps://bio.halowerk.com/v1/biomarker-longevityStandardizes each supplied value against its supplied mean and standard deviation, flips markers whose favorable direction is lower, and computes a weighted composite mapped to a bounded 0–100 index. The references and weights come entirely
- Biowerk0,004 USDC
crispr offtarget
POSThttps://bio.halowerk.com/v1/crispr-offtargetCompares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulg