HALOWERKBiowerk
crispr offtarget
Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.
POST https://bio.halowerk.com/v1/crispr-offtargetEingaben
| Feld | Typ | Pflicht | Beschreibung |
|---|---|---|---|
| guide | string | Ja | Guide sequence written 5-prime to 3-prime. |
| candidates | array | Ja |
Vollständiges Eingabeschema anzeigen
{
"type": "object",
"required": [
"guide",
"candidates"
],
"additionalProperties": false,
"properties": {
"guide": {
"type": "string",
"minLength": 17,
"maxLength": 30,
"pattern": "^[ACGT]+$",
"description": "Guide sequence written 5-prime to 3-prime."
},
"candidates": {
"type": "array",
"minItems": 1,
"maxItems": 1000,
"items": {
"type": "object",
"required": [
"id",
"protospacer",
"pam"
],
"additionalProperties": false,
"properties": {
"id": {
"type": "string",
"minLength": 1,
"maxLength": 128
},
"protospacer": {
"type": "string",
"minLength": 17,
"maxLength": 30,
"pattern": "^[ACGT]+$"
},
"pam": {
"type": "string",
"minLength": 2,
"maxLength": 8,
"pattern": "^[ACGT]+$"
}
}
}
}
}
}Veröffentlichtes Eingabebeispiel
{
"guide": "GAGTCCGAGCAGAAGAAGAA",
"candidates": [
{
"id": "candidate-1",
"protospacer": "GAGTCCGAGCAGAAGAAGAA",
"pam": "AGG"
},
{
"id": "candidate-2",
"protospacer": "GAGTCCGAGCAGAAGATGAA",
"pam": "TGG"
},
{
"id": "candidate-3",
"protospacer": "GACTCCGAGCAGAAGAAGAT",
"pam": "TGA"
}
]
}Ergebnis & Dokumentation
Maschinenlesbare Dokumentation dieses Hubs
Quelle dieser Seite: der veröffentlichte HALOWERK-Katalog. Stand: 2026-11-01, 15:19 UTC.
Weitere Endpunkte dieses Hubs
- Biowerk0,004 USDC
allergen epitope
POSThttps://bio.halowerk.com/v1/allergen-epitopeBuilds amino-acid k-mer sets, calculates Jaccard similarity, and finds the highest contiguous identity between each supplied epitope and any equal-length window of the query. It does not predict immune binding, allergenicity, cross-reactivi
- Biowerk0,003 USDC
biomarker longevity
POSThttps://bio.halowerk.com/v1/biomarker-longevityStandardizes each supplied value against its supplied mean and standard deviation, flips markers whose favorable direction is lower, and computes a weighted composite mapped to a bounded 0–100 index. The references and weights come entirely
- Biowerk0,003 USDC
dna storage encode
POSThttps://bio.halowerk.com/v1/dna-storage-encodeMaps each two-bit group of caller-supplied UTF-8 bytes to A, C, G or T and reports a SHA-256 checksum of the original bytes. This reversible representation performs no biological synthesis, homopolymer balancing, GC optimization, addressing